Translation
Home Up Transcription Translation Replication Review of Processes

 

Translation

The messenger RNA formed in the transcription process moves to (or is taken to) a different part of the cell called the ribosome where its genetic code is interpreted or translated into an amino acid sequence.

This is done by taking each three base units as a larger unit called a codon. In the ribosome, another molecule called transfer RNA is lined up in sequence with each codon having its own anti-codon so that uracil lines up with adenine, guanine lines up with cytosine, and uracil lines up with adenine.

Diagram of tRNA anti-codon matching up with mRNA codon. [69045.jpg]

Each tRNA molecule has a particular section called an anti-codon that has to match up with the codon on the messenger RNA. At the other end of the tRNA molecule is attached a particular amino acid.

Diagram of second tRNA anti-codon matching up with mRNA codon. [69046.jpg]

As the transfer RNA molecules are lined up with the messenger RNA molecules, the amino acids are bonded to one another and then cleaved by hydrolysis from the remainder of the transfer RNA. In this way, a sequence of amino acids is put together to make a protein. That sequence of amino acids is the primary structure of the protein which in turn determines its secondary and tertiary (and perhaps quaternary) structure.

Diagram of amino acids from two tRNAs being linked. [69047.jpg]

 

Practice

Using the mRNA segment from the previous practice exercise, draw the anti-codon portions of the tRNA molecules that will bond to it. Check your answer below and then keep your answer handy for the next practice exercise.

Answer

      |           |    |           |
      P           P    P           P
       \         /      \         /
        R-P-R-P-R        R-P-R-P-R
        |   |   |        |   |   |
        C   U   A        G   C   U

        G   A   U       C   G   A
        |   |   |       |   |   |
     -P-R-P-R-P-R - P - R-P-R-P-R-P-

 

Codons

The amino acids that correspond to each codon are listed here (and in the table in Example 15.a in your workbook). Each amino acid corresponds with anywhere from one to six specific codons. In addition, three codons are used for starting and stopping sequences rather than specifying amino acids to be added to the sequence. Note that the base sequences shown here are codons (mRNA) rather than anti-codons (tRNA). The following exercises will give you practice using the table to match codons and amino acids.

Table of Codons
UUU   Phe
UUC   Phe
UUA   Leu
UUG   Leu
UCU   Ser
UCC   Ser
UCA   Ser
UCG   Ser
UAU   Tyr
UAC   Tyr
UAA  Stop
UAG  Stop
UGU   Cys
UGC   Cys
UGA  Stop
UGG   Trp
CUU   Leu
CUC   Leu
CUA   Leu
CUG   Leu
CCU   Pro
CCC   Pro
CCA   Pro
CCG   Pro
CAU   His
CAC   His
CAA   Gln
CAG   Gln
CGU   Arg
CGC   Arg
CGA   Arg
CGG   Arg
AUU   Ile
AUC   Ile
AUA   Ile
AUG   Met
ACU   Thr
ACC   Thr
ACA   Thr
ACG   Thr
AAU   Asn
AAC   Asn
AAA   Lys
AAG   Lys
AGU   Ser
AGC   Ser
AGA   Arg
AGG   Arg
GUU   Val
GUC   Val
GUA   Val
GUG   Val
GCU   Ala
GCC   Ala
GCA   Ala
GCG   Ala
GAU   Asp
GAC   Asp
GAA   Glu
GAG   Glu
GGU   Gly
GGC   Gly
GGA   Gly
GGG   Gly

Practice

Use the table of codons to determine which amino acid would be attached to the other end of each of the tRNA molecules for which you drew the anti-codons in the previous practice exercise. Note that the table is based on codons (mRNA) rather than anti-codons even though the amino acid is attached to the tRNA. Presume the mRNA codons are read from left to right.

Answer

          Asp              Arg
              \                \
               \                \
                \                \
      |          \     |          \
      P           P    P           P
       \         /      \         /
        R-P-R-P-R        R-P-R-P-R
        |   |   |        |   |   |
        C   U   A        G   C   U

        G   A   U       C   G   A
        |   |   |       |   |   |
     -P-R-P-R-P-R - P - R-P-R-P-R-P-

 

More Practice

A simpler method of representing the structure of mRNA is to list the sequence of nucleotides using just the letters representing the bases (A, U, C, G) and leaving out the ribose and phosphate units. With that in mind, determine what amino acid sequence would be dictated by the following sequences of bases in mRNA. Use your table of codons and read the following segments from left to right. (These are also given in Exercise 15.b in your workbook.)

CUUUUAGCACGACAACAAUGUUGA
UAUCAAGAUGAUACAGUUUUUUAG
AAAAAAAAAAAAUUUUUUUUUUAA

Answers

Leu-Leu-Ala-Arg-Gln-Gln-Cys-STOP
Tyr-Gln-Asp-Asp-Thr-Val-Phe-STOP
Lys-Lys-Lys-Lys-Phe-Phe-Phe-STOP

 

Top of Page

E-mail instructor: Sue Eggling

Clackamas Community College
©2001, 2003 Clackamas Community College, Hal Bender